Related Experiment Video
Updated: Aug 17, 2026

Quantitative PCR of T7 Bacteriophage from Biopanning
Published on: September 27, 2018
The nucleotide sequence of bacteriophage T5 glutamine transfer RNA
Abstract:
Uniformly 32P-labeled phage-specific tRNAGln has been isolated from bacteriophage T5-infected Escherichia coli cells and its nucleotide sequence has been determined using thin-layer chromatography on cellulose to fractionate the oligonucleotides. The sequence is: pUGGGGAUUAGCUUAGCUUGGCCUAAAGCUUCGGCCUUUGAAG psi CGAGAUCAUUGGT psi CAAAUCCAAUAUCCCCUGCCAOH. The main feature of this tRNA is the absence of Watson-Crick pairing between the 5'-terminal base and the fifth base from its 3'-end. The structure of tRNA was confirmed by DNA sequencing of its gene.
Related Concept Videos
Transfer RNA Synthesis
Each of these chemical modifications is carried by a specific enzyme, post-transcription. All of these enzymes have unique base and site-specificity. Methylation, the most common chemical modification, is carried by at least nine different enzymes, with...
tRNA Activation
Leaky Scanning
Viral Replication: Lytic Cycle
DNA Bacteriophages
Bacteriophages of the Human Virome

