Yeast deRNA viral transcriptase pause products: identification of the transcript strand

Area of Science:

• Virology
• Molecular Biology
• Mycology

Background:

• Saccharomyces cerevisiae virus L (ScV-L) is a double-stranded RNA virus.
• ScV-L encodes a transcriptase activity responsible for RNA synthesis.

Purpose of the Study:

• To determine the transcription initiation site of the ScV-L double-stranded RNA template.
• To characterize the products of ScV-L transcription.

Main Methods:

• Analysis of ScV-L RNA template (L).
• Identification of transcription initiation sequences.
• Characterization of RNA transcription products.

Main Results:

• The U-rich 3' terminus of the L strand serves as the transcription initiation site.
• Multiple pause products are generated during transcription.
• A specific prominent pause product sequence (pppGAAAAAUUUUUAAAUUCAUAUAACUOH) was identified.

Conclusions:

• The 3' terminus of ScV-L dsRNA dictates transcription start.
• Understanding viral RNA synthesis mechanisms in yeast is crucial for virology research.