Hairpin formation within the human enkephalin enhancer region. 2. Structural studies

Receptor-mediated induction of the human proenkephalin gene has been mapped to an imperfect palindrome located between -104 and -86, upstream of the transcriptional start site. Several lines of evidence suggest that receptor-mediated transcription of proenkephalin involves a reversible conformational change from duplex to a hairpin state of the enhancer [McMurray, C.T., Wilson, W.D., & Douglass, J.O. (1991) Proc. Natl. Acad. Sci. U.S.A. 88, 666]. To determine the structure that would form if such a conformational change took place, we have synthesized two 23-bp oligonucleotides, d(GCTGGCGTAGGGCCTGCGTCAGC) and d(GCTGACGCAGGCCCTACGCCAGC), whose sequences are identical to the top and the bottom strands of the native enhancer. We have found that each oligonucleotide strand exists primarily as a hairpin structure over a wide range of oligonucleotide concentrations and a wide range of temperatures (0-45 degrees C). The assignment of each imino proton was carried out using 1D and 2D nuclear Overhauser effects (NOE) and by comparison with the spectra of hairpins containing single base substitutions. The hairpin structure for each oligonucleotide contains a 3-member loop, a 10-bp stem, and two mismatched pairs. The hairpin that forms from the top strand of the enhancer and contains two GT mispaired bases creates an alternative binding site for the cyclic adenosine monophosphate element binding protein (CREB), a transcription factor that binds to and regulates the human proenkephalin gene. Circular dichroism and 31P NMR indicate that, despite the presence of mismatched pairs, each oligonucleotide hairpin adopts a B-form conformation with no unusual bending or kinking. The structure of the hairpin may explain the effect on expression of point mutations within the enhancer.