Related Experiment Videos
The DNA-binding and transcription-activation abilities of p53 are necessary but not sufficient for its
W Zhang1, G S Randhawa, X Y Guo
1Department of Hematology, University of Texas M.D. Anderson Cancer Center, Houston 77030.
Abstract:
Normal p53 protein suppresses cell proliferation and ras oncogene-induced cell transformation. Missense mutations in the middle conserved conformational domain of p53 decrease its antiproliferation function. In this work, we studied the requirement of the NH2- and COOH-terminal regions of p53 in its antiproliferation function using two independent assays, growth of chronic myelogenous leukemia K562 cells on methylcellulose semisolid medium and ras oncogene-induced focus formation of rat fibroblast cells (Rat-1). We found that deletion of 80 or 159 amino acids from the NH2-terminus and deletion of 67 amino acids from the COOH-terminus of p53 drastically reduced the antiproliferation function of p53. However, the COOH-terminal deletion mutant is capable of binding to a p53 DNA-binding element, p53CON (GGACATGCCCGGGCATGTCC), and of activating p53CON-mediated transcription. These results suggest that p53' abilities to bind p53CON and activate transcription are not sufficient for its antiproliferation function and that p53CON-regulated genes may not be growth suppressive.
Insights
The tumor suppressor protein p53
Area of Science:
- Molecular Biology
- Cell Biology
- Oncology
Background:
- The p53 protein is a critical tumor suppressor that inhibits cell proliferation and transformation.
- Mutations in the p53 gene are common in cancer and often affect its antiproliferative function.
- The NH2- and COOH-terminal regions of p53 are essential for its tumor-suppressing activity.
Purpose of the Study:
- To investigate the role of the NH2- and COOH-terminal regions of p53 in its antiproliferation function.
- To determine if DNA binding and transcriptional activation are sufficient for p53's antiproliferation activity.
Main Methods:
- Utilized two assays: methylcellulose growth assay for K562 cells and focus formation assay for Rat-1 fibroblasts.
- Constructed and tested p53 deletion mutants lacking portions of the NH2- or COOH-termini.
- Assessed DNA binding to the p53CON element and p53CON-mediated transcriptional activation.
Main Results:
- Deletion of 80 or 159 amino acids from the NH2-terminus significantly impaired p53's antiproliferation function.
- Deletion of 67 amino acids from the COOH-terminus also drastically reduced antiproliferation activity.
- The COOH-terminal deletion mutant retained the ability to bind p53CON and activate transcription.
Conclusions:
- The NH2- and COOH-terminal regions of p53 are crucial for its antiproliferation function.
- p53's ability to bind DNA and activate transcription is not sufficient for its growth-suppressive role.
- Genes regulated by p53CON may not be involved in growth suppression.