Related Experiment Videos
[ABO genotyping by polymerase chain reaction (PCR) and its application to paternity testing]
1Department of Legal Medicine, Kochi Medical School, Nankoku, Japan.
Abstract:
The authors describe the usefulness of ABO genotyping by polymerase chain reaction (PCR) in paternity testing. Blood samples were obtained from 80 unrelated Japanese (20 samples in each of phenotypes of the ABO blood group system) and 13 cases of disputed paternity. PCR amplification of DNA extracted from blood by a conventional extraction procedure was carried out using the primers (primer 1: CACCGTGGAAGGATGTCCTC; primer 2: AATGTCCACAGTCACTCGCC; primer 3: TGGAGATCCTGACTCCGCTG; primer 4: GTAGAAATCGCCCTCGTCCTT) described by Lee and Chang (J Forensic Sci, Vol. 37). The amplified DNA products using primer 1 and 2 and the amplified DNA products using primer 3 and 4 were digested with Kpn I and Alu I, respectively. The amplified and digested DNA products were then analysed by electrophoresis on polyacrylamide gels. The bands on gels stained with ethidium bromide were observed with UV light and with silver staining. In 20 samples of phenotype A, genotype AA was recognized in five samples and the others were genotype AO. In 20 samples of phenotype B, three samples were genotype BB and the others were genotype BO. According to this procedure, genotypes of phenotype AB and O were clearly and consistently confirmed. In 13 cases of disputed paternity, the paternity of six cases was excluded with some of red cell, serum protein, enzyme genetic markers and HLA systems except ABO phenotype. However, the paternity of three cases out of these six cases was excluded with ABO genotype. This study seems to support the usefulness of ABO genotyping by PCR in paternity testing.