Related Experiment Videos
Novel DNA binding of p53 mutants and their role in transcriptional activation
W Zhang1, W D Funk, W E Wright
1Department of Hematology, University of Texas M.D. Anderson Cancer Center, Houston 77030.
Abstract:
The protein product of the normal p53 gene binds to the DNA p53CON element (GGACATGCCCGGGCATGTCC, Funk et al., 1992), thereby activating transcription from adjacent promoters. Two mutants, 248 (Arg-->Trp) and 281 (Asp-->Gly), failed to bind p53CON and to activate transcription. However, in contrast to previous reports that all p53 mutants fail to bind to the other p53 binding elements, two p53 mutants, 143 (Val-->Ala) and 273 (Arg-->His), retained both p53CON binding and transcriptional activation functions. A third mutant 175 (Arg-->His) bound to the p53CON but did not activate transcription. These data suggest that the DNA binding and transcriptional activation functions of p53 mutants in tumor cells are dependent on the specific missense mutations acquired in the p53 gene and the target sequences of p53 in the genome.
Insights
Mutant p53 proteins show varied DNA binding and transcriptional activity. Specific mutations in the p53 gene influence its ability to bind DNA and activate gene transcription, impacting tumor cell function.
Area of Science:
- Molecular Biology
- Cancer Genetics
- Protein Biochemistry
Background:
- The p53 gene is a critical tumor suppressor.
- Normal p53 protein binds DNA and activates transcription.
- Mutations in p53 are common in cancer.
Purpose of the Study:
- To investigate how specific p53 missense mutations affect DNA binding and transcriptional activation.
- To determine if p53 mutants retain function on specific DNA binding elements.
Main Methods:
- Analysis of p53 mutant protein binding to the p53CON DNA element.
- Assay of transcriptional activation by p53 mutants.
Main Results:
- Mutants 248 and 281 lost p53CON binding and transcriptional activity.
- Mutants 143 and 273 retained both p53CON binding and transcriptional activity.
- Mutant 175 bound p53CON but failed to activate transcription.
Conclusions:
- p53 DNA binding and transcriptional activation are mutation-dependent.
- Specific missense mutations dictate p53 functional outcomes.
- Tumor cell p53 activity is influenced by specific genetic alterations and genomic targets.