Sequence from the assembly nucleation region of TMV RNA

In an effort to isolate RNA sequences containing the assembly nucleation region, uniformly 32P-labeled tobacco mosaic virus RNA was partially digested with pancreatic ribonuclease, and the mixture of fragments was incubated with limited amounts of tobacco mosaic virus protein disks in conditions favorable for reconstitution. The RNA fragments which became encapsidated were purified and sequenced by conventional techniques. The sequence of the first 139 nucleotides of P1, the principal encapsidated fragment, is AGGUUUGAGAGAGAAGAUUACAAGCGUGAGAGACGGAGGGCCCAUGGAACUUACAGAAGAAGUUGUUGAUGAGUUCAUGGAAGAUGUCCCUAUGUCAAUCAGACUUGCAAAGUUUCGAUCUCGAACCGGAAAAAAGAGU. Residues 1--110 of P1 overlap the assembly origin isolated and characterized in the accompanying papers by Zimmern (1977) and Zimmern and Butler (1977). Our results, taken in conjunction with the two accompanying papers, define the sequence of much of the nucleation region as well as sequences flanking it on both sides. The features of the P1 sequence which may have role in the nucleation reaction are discussed in detail in the text.