Related Experiment Videos

[Irregular temperature dependence of the efficiency of nucleic acids site-directed modification by oligonucleotide

N V Amirkhanov¹, N V Neronova

¹Novosibirsk Institute of Bioorganic Chemistry, Siberian Division, Russian Academy of Sciences, Novosibirsk, Russia.

Bioorganicheskaia Khimiia

|April 29, 1998

Abstract:

A 22-mer target DNA pTGCCTGGAGCTGCTTGATGCCC (I) was modified by a dodecadeoxyribonucleotide reagent GCATCAAGCAGCp[N(CH3)CH2RCl] (II) containing a 3'-terminal alkylating group (RCl = -C6H4N(CH3)(CH2CH2Cl). An anomalous, bell-shaped temperature dependence of the maximum extent of the modification was found. Based on the analysis of the kinetic scheme of the modification, a possible explanation for this experimental fact is given.

Related Concept Videos

Articles linked to this work by shared authors, journal, and citation graph.

[Composites of Peptide Nucleic Acids with Titanium Dioxide Nanoparticles. IV+. Antiviral Activity of Nanocomposites Containing DNA/PNA Duplexes].

Bioorganicheskaia khimiia·2015

[Composites of peptide nucleic acids with titanium dioxide nanoparticles. III. Kinetics of PNA dissociation from nanocomposites containing DNA/PNA duplexes].

Bioorganicheskaia khimiia·2015

[Affinity capture of specific DNA fragments with the use of short synthetic sequences].

Bioorganicheskaia khimiia·2013

[Composites of peptide nucleic acids with titanium dioxide nanoparticles. I. Construction of nanocomposites containing DNA/PNA duplexes and their delivery into HeLa cells].

Bioorganicheskaia khimiia·2013

Synthesis of novel polydiamidopropanoate dendrimer PNA-peptide chimeras for non-invasive magnetic resonance imaging of cancer.

Nucleosides, nucleotides & nucleic acids·2005

Cross-modulation of the pKa of nucleobases in a single-stranded hexameric-RNA due to tandem electrostatic nearest-neighbor interactions.

Journal of the American Chemical Society·2003

See all related articles