Search research articles
Contact Us
Filters
Showing results (101-110 of 144) with videos related to
Page
of 15
Sort By:
Optics Express
|
December 28, 2019
Experimental study of an in-fiber acousto-optic tunable bandpass filter for single- and dual-wavelength operation in a thulium-doped fiber laser
E Hernández Escobar, M Bello Jiménez, A Camarillo Avilés, et al.
Revista De Neurologia
|
November 19, 2002
[Study of the hypoplasic internal carotid artery by use of multislice spiral computed tomography. Two case reports]
B Ibarra de Grassa, F J Romero-Vidal, M M Alarcón-Alcaraz, et al.
Revista De Investigacion Clinica; Organo Del Hospital De Enfermedades De La Nutricion
|
July 1, 1981
Glucose-6-phosphate dehydrogenase deficiency and abnormal hemoglobins in mexican newborns with jaundice
G Vaca, B Ibarra, A Hernández, et al.
Biophysical Journal
|
August 19, 2009
Single centrosome manipulation reveals its electric charge and associated dynamic structure
S Hormeño, B Ibarra, F J Chichón, et al.
Revista Argentina De Microbiologia
|
January 14, 2011
[Histoplasmosis outbreak in Morón, Buenos Aires Province, Argentina]
R Negroni, R Duré, A Ortiz Nareto, et al.
Acta Anthropogenetica
|
January 1, 1982
Screening for inborn errors of the erythrocyte metabolism in Northwestern Mexico
G Vaca, B Ibarra, A Hernandez, et al.
Boletin Medico Del Hospital Infantil De Mexico
|
August 1, 1985
[Hereditary erythrocyte enzymopathies in newborn infants with hyperbilirubinemia]
A L Velázquez, N G Rico, B Ibarra, et al.
Proceedings of the National Academy of Sciences of the United States of America
|
May 11, 2004
Bacteriophage capsids: tough nanoshells with complex elastic properties
I L Ivanovska, P J de Pablo, B Ibarra, et al.
Optics Express
|
June 6, 2019
Long cavity ring fiber mode-locked laser with decreased net value of nonlinear polarization rotation
L A Rodriguez-Morales, I Armas-Rivera, B Ibarra-Escamilla, et al.
International Journal of Laboratory Hematology
|
June 13, 2017
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients
L C Rizo-de-la-Torre, B Ibarra, J Y Sánchez-López, et al.
Page
of 15
Search research articles
Search
Showing results (101-110 of 144) with videos related to
Sort By:
Page
of 15
Optics Express
|
December 28, 2019
Experimental study of an in-fiber acousto-optic tunable bandpass filter for single- and dual-wavelength operation in a thulium-doped fiber laser
E Hernández Escobar, M Bello Jiménez, A Camarillo Avilés, et al.
Revista De Neurologia
|
November 19, 2002
[Study of the hypoplasic internal carotid artery by use of multislice spiral computed tomography. Two case reports]
B Ibarra de Grassa, F J Romero-Vidal, M M Alarcón-Alcaraz, et al.
Revista De Investigacion Clinica; Organo Del Hospital De Enfermedades De La Nutricion
|
July 1, 1981
Glucose-6-phosphate dehydrogenase deficiency and abnormal hemoglobins in mexican newborns with jaundice
G Vaca, B Ibarra, A Hernández, et al.
Biophysical Journal
|
August 19, 2009
Single centrosome manipulation reveals its electric charge and associated dynamic structure
S Hormeño, B Ibarra, F J Chichón, et al.
Revista Argentina De Microbiologia
|
January 14, 2011
[Histoplasmosis outbreak in Morón, Buenos Aires Province, Argentina]
R Negroni, R Duré, A Ortiz Nareto, et al.
Acta Anthropogenetica
|
January 1, 1982
Screening for inborn errors of the erythrocyte metabolism in Northwestern Mexico
G Vaca, B Ibarra, A Hernandez, et al.
Boletin Medico Del Hospital Infantil De Mexico
|
August 1, 1985
[Hereditary erythrocyte enzymopathies in newborn infants with hyperbilirubinemia]
A L Velázquez, N G Rico, B Ibarra, et al.
Proceedings of the National Academy of Sciences of the United States of America
|
May 11, 2004
Bacteriophage capsids: tough nanoshells with complex elastic properties
I L Ivanovska, P J de Pablo, B Ibarra, et al.
Optics Express
|
June 6, 2019
Long cavity ring fiber mode-locked laser with decreased net value of nonlinear polarization rotation
L A Rodriguez-Morales, I Armas-Rivera, B Ibarra-Escamilla, et al.
International Journal of Laboratory Hematology
|
June 13, 2017
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients
L C Rizo-de-la-Torre, B Ibarra, J Y Sánchez-López, et al.
Page
of 15