Showing results (1241-1250 of 2,150) with videos related to
Sort By:
Pageof 215
International Journal of Laboratory Hematology|August 12, 2008
Effect of HbS in the determination of HbA2 with the Menarini HA-8160 analyzer and comparison with other instrumentsK Anagnostopoulos, I Tentes, C Kalleas, et al.International Journal of Laboratory Hematology|August 12, 2008
Review of the UK NEQAS (H) digital morphology pilot scheme for continuing professional development accessed via the internetM L Brereton, B DE LA Salle, J Burthem, et al.International Journal of Laboratory Hematology|June 27, 2017
Higher rate of central nervous system involvement by flow cytometry than morphology in acute lymphoblastic leukemiaJ Dass, A Dayama, P C Mishra, et al.International Journal of Laboratory Hematology|February 13, 2010
Are 10 min of seating enough to guarantee stable haemoglobin and haematocrit readings for the athlete's biological passport?C Ahlgrim, T Pottgiesser, N Robinson, et al.International Journal of Laboratory Hematology|June 13, 2017
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patientsL C Rizo-de-la-Torre, B Ibarra, J Y Sánchez-López, et al.International Journal of Laboratory Hematology|June 13, 2017
Thrombophilic gene polymorphisms and recurrent pregnancy loss in Greek womenM Chatzidimitriou, D Chatzidimitriou, M Mavridou, et al.International Journal of Laboratory Hematology|February 9, 2010
Evaluation of mean sphered corpuscular volume for predicting hereditary spherocytosisJ Broséus, B Visomblain, J Guy, et al.International Journal of Laboratory Hematology|July 27, 2018
The clinical utility of new reticulocyte and erythrocyte parameters on the Sysmex XN 9000 for iron deficiency in pregnant patientsShani Levy, Elise SchapkaitzInternational Journal of Laboratory Hematology|August 2, 2018
An integrated flow cytometry analysis of 286 mature B cell neoplasms identifies CD13 as a useful marker for diagnostic subtypingHubert Lau, Alexandra Nagy, Susan K Atwater, et al.International Journal of Laboratory Hematology|July 19, 2018
Development and validation of a liquid chromatography/tandem mass spectrometry method for the simultaneous quantification of serotonin and thromboxane B2 from activated plateletsValentine Minet, Jonathan Evrard, Christelle Vancraeynest, et al.Pageof 215