Showing results (691-700 of 2,147) with videos related to
Sort By:
Pageof 215
International Journal of Laboratory Hematology|May 4, 2007
Obligatory premarital tests for beta-thalassaemia in the Gaza Strip: evaluation and recommendationsI Tarazi, E Al Najjar, N Lulu, et al.International Journal of Laboratory Hematology|January 17, 2007
Spurious counts and spurious results on haematology analysers: a review. Part II: white blood cells, red blood cells, haemoglobin, red cell indices and reticulocytesM Zandecki, F Genevieve, J Gerard, et al.International Journal of Laboratory Hematology|July 10, 2007
Application of flow cytometry-based genotyping for rapid detection of hemoglobin variantsS Aslanian, M Azimi, J Noble, et al.International Journal of Laboratory Hematology|August 12, 2008
Effect of HbS in the determination of HbA2 with the Menarini HA-8160 analyzer and comparison with other instrumentsK Anagnostopoulos, I Tentes, C Kalleas, et al.International Journal of Laboratory Hematology|August 12, 2008
Review of the UK NEQAS (H) digital morphology pilot scheme for continuing professional development accessed via the internetM L Brereton, B DE LA Salle, J Burthem, et al.International Journal of Laboratory Hematology|June 27, 2017
Higher rate of central nervous system involvement by flow cytometry than morphology in acute lymphoblastic leukemiaJ Dass, A Dayama, P C Mishra, et al.International Journal of Laboratory Hematology|February 13, 2010
Are 10 min of seating enough to guarantee stable haemoglobin and haematocrit readings for the athlete's biological passport?C Ahlgrim, T Pottgiesser, N Robinson, et al.International Journal of Laboratory Hematology|June 13, 2017
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patientsL C Rizo-de-la-Torre, B Ibarra, J Y Sánchez-López, et al.International Journal of Laboratory Hematology|June 13, 2017
Thrombophilic gene polymorphisms and recurrent pregnancy loss in Greek womenM Chatzidimitriou, D Chatzidimitriou, M Mavridou, et al.International Journal of Laboratory Hematology|February 9, 2010
Evaluation of mean sphered corpuscular volume for predicting hereditary spherocytosisJ Broséus, B Visomblain, J Guy, et al.Pageof 215