Francisco Javier Perea-Díaz
2PUBLICATIONS
7CO-AUTHORS
Get your video featured.
Publish with JoVEGet your video featured.
Publish with JoVE
Publications (2)
Sort by Publication Date:
|Aug 06, 2024
Frequency of rs1051338 and rs116928232 Variants in Individuals from Northwest Mexico.Angélica Alejandra Hernández-Orozco, Lennon Melendez-Aranda, Sandra Del Carmen Mendoza-Ruvalcaba
|Jun 13, 2017
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.L C Rizo-de-la-Torre, B Ibarra, J Y Sánchez-López
Pageof 1
Frequent Collaborators
1 joint publications
Angélica Alejandra Hernández-Orozco
1 joint publications
Lennon Melendez-Aranda
1 joint publications
Sandra Del Carmen Mendoza-Ruvalcaba
1 joint publications
Jorge J Cebolla
1 joint publications
Pilar Giraldo
1 joint publications
Aniel Jessica Leticia Brambila-Tapia
1 joint publications
José Elías García-Ortíz
