Jove
Visualize
Contáctanos
JoVE
x logofacebook logolinkedin logoyoutube logo
ACERCA DE JoVE
Visión GeneralLiderazgoBlogCentro de Ayuda JoVE
AUTORES
Proceso de PublicaciónConsejo EditorialAlcance y PolíticasRevisión por ParesPreguntas FrecuentesEnviar
BIBLIOTECARIOS
TestimoniosSuscripcionesAccesoRecursosConsejo Asesor de BibliotecasPreguntas Frecuentes
INVESTIGACIÓN
JoVE JournalMethods CollectionsJoVE Encyclopedia of ExperimentsArchivo
EDUCACIÓN
JoVE CoreJoVE BusinessJoVE Science EducationJoVE Lab ManualCentro de Recursos para ProfesoresSitio de Profesores
Términos y Condiciones de Uso
Política de Privacidad
Políticas

Videos de Conceptos Relacionados

The DNA Helix01:16

The DNA Helix

Overview
The DNA Helix01:16

The DNA Helix

Overview
DNA as a Genetic Template02:05

DNA as a Genetic Template

Two structural features of the DNA molecule provide a basis for the mechanisms of heredity: the four nucleotide bases and its double-stranded nature. The Watson-Crick model of double-helical DNA structure, proposed in 1952, drew heavily upon the X-ray crystallography work of researchers Rosalind Franklin and Maurice Wilkins. Watson, Crick, and Wilkins jointly received the Nobel Prize in Physiology or Medicine for their work in 1962. Franklin was, controversially, excluded from the prize for...
Genome Copying Errors02:46

Genome Copying Errors

DNA replication is a well-evolved process that copies millions of base pairs with high fidelity during each cell division. Occasionally a wrong base or a long stretch of wrong bases may get added to the daughter strands. If the errors are left unchecked, cells might accumulate several mutations that might endanger their  survival. Therefore, the copying errors are checked and repaired at three levels.
The DNA Helix01:07

The DNA Helix

Deoxyribonucleic acid, or DNA, is the genetic material responsible for passing traits from generation to generation in all organisms and most viruses. DNA is composed of two strands of nucleotides that wind around each other to form a spring-like structure called a double helix. However, the double helix is not perfectly symmetrical. Instead, there are regularly occurring grooves in the structure. The major groove occurs where the sugar-phosphate backbones are relatively far apart. This space...
DNA as a Genetic Template02:05

DNA as a Genetic Template

Two structural features of the DNA molecule provide a basis for the mechanisms of heredity: the four nucleotide bases and its double-stranded nature. The Watson-Crick model of double-helical DNA structure, proposed in 1952, drew heavily upon the X-ray crystallography work of researchers Rosalind Franklin and Maurice Wilkins. Watson, Crick, and Wilkins jointly received the Nobel Prize in Physiology or Medicine for their work in 1962. Franklin was, controversially, excluded from the prize for...

También podría leer

Artículos Relacionados

Artículos vinculados a este trabajo por autores compartidos, revista y gráfico de citas.

Ordenar por
Same author

Sport Supplement Use in 14-18-Year-Old Adolescents: A Single-Group Pre-Post Social Media Educational Intervention Study.

Nutrients·2026
Same author

Spatially tunable multiomic sequencing using light-driven combinatorial barcoding of molecules in tissues.

Proceedings of the National Academy of Sciences of the United States of America·2026
Same author

Multifaceted biological and computational assessment of aromatic and N-heteroaromatic non-substituted thiosemicarbazones.

Scientific reports·2026
Same author

Degradation of G-quadruplex-binding proteins in chromatin using G4-ligand-based proteolysis-targeting chimeras.

Nature chemistry·2026
Same author

Novel Pyridine-Based Thiazolyl-Hydrazone as a Promising Attenuator of <i>Pseudomonas aeruginosa</i> Pathogenicity by Targeting Quorum Sensing.

International journal of molecular sciences·2026
Same author

Dissecting the Binding Interactions of the Chromatin Remodeler SMARCA4 with G-Quadruplex DNA.

Biochemistry·2026

Video Experimental Relacionado

Updated: Jul 9, 2026

Protocols for C-Brick DNA Standard Assembly Using Cpf1
12:03

Protocols for C-Brick DNA Standard Assembly Using Cpf1

Published on: June 15, 2017

Formación de cuádruplejo de ADN putativo dentro del kit oncogénico c-gene humano.

Sarah Rankin1, Anthony P Reszka, Julian Huppert

  • 1Cancer Research UK Biomolecular Structure Group, The School of Pharmacy, University of London, 29-39 Brunswick Square, London WC1N 1AX, UK.

Journal of the American Chemical Society
|July 28, 2005
PubMed
Resumen
Este resumen es generado por máquina.

Una secuencia específica de ADN en el promotor oncogénico del kit-c forma una estructura cuadruplex estable. Este hallazgo sugiere que existen menos estructuras de este tipo en el genoma y ofrece un nuevo objetivo potencial de terapia contra el cáncer.

Más Videos Relacionados

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture (4C-seq)
09:06

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture (4C-seq)

Published on: October 5, 2018

Stable DNA Motifs, 1D and 2D Nanostructures Constructed from Small Circular DNA Molecules
09:32

Stable DNA Motifs, 1D and 2D Nanostructures Constructed from Small Circular DNA Molecules

Published on: April 12, 2019

Videos de Experimentos Relacionados

Last Updated: Jul 9, 2026

Protocols for C-Brick DNA Standard Assembly Using Cpf1
12:03

Protocols for C-Brick DNA Standard Assembly Using Cpf1

Published on: June 15, 2017

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture (4C-seq)
09:06

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture (4C-seq)

Published on: October 5, 2018

Stable DNA Motifs, 1D and 2D Nanostructures Constructed from Small Circular DNA Molecules
09:32

Stable DNA Motifs, 1D and 2D Nanostructures Constructed from Small Circular DNA Molecules

Published on: April 12, 2019

Área de la Ciencia:

  • La genómica es la genómica.
  • Biología Estructural Biología estructural.
  • Oncología Oncología.

Sus antecedentes:

  • El oncogén del c-kit juega un papel en varios tipos de cáncer.
  • El ADN puede formar estructuras complejas más allá de la doble hélice, como los cuadruplexos.
  • La prevalencia de los cuádruplexos genómicos no se entiende completamente.

Objetivo del estudio:

  • Para investigar las propiedades estructurales de una secuencia específica de ADN del promotor de oncogenes c-kit.
  • Para determinar si esta secuencia forma una estructura cuadruplex bajo condiciones fisiológicas.
  • Para evaluar el impacto de las variaciones de secuencia en la formación cuadruplex.

Principales métodos:

  • La espectroscopia de resonancia magnética nuclear (RMN) también se conoce como espectroscopia de resonancia magnética nuclear.
  • Espectroscopía de dicroísmo circular (CD) espectroscopía de dicroísmo circular (CD) espectroscopía de dicroísmo circular (CD) espectroscopía de dicroísmo circular (CD) espectroscopía de dicroísmo circular (CD) espectroscopía de dicroísmo circular (CD) espectroscopía de dicroísmo circular (CD) espectroscopía de dicroísmo circular (CD) espectroscopía de dicroísmo circular
  • Las mediciones de la temperatura de fusión (Tm)

Principales resultados:

  • La secuencia de ADN d ((AGGGAGGGCGCTGGGAGGAGGG) forma una estructura cuadruplex estable de cuatro hebras.
  • Esta formación cuadruplexa ocurre bajo condiciones fisiológicas.
  • Pequeñas modificaciones en la secuencia entre los tractos de guanina impidieron la formación de cuadruplexos.

Conclusiones:

  • El promotor c-kit contiene una secuencia capaz de formar una estructura G-cuadruplex.
  • La formación genómica de cuadruplexos puede ser menos común de lo que se suponía anteriormente.
  • El c-kit quadruplex representa un potencial nuevo objetivo terapéutico para los cánceres impulsados por c-kit.