Related Experiment Video
Updated: Aug 9, 2026

Analyzing and Building Nucleic Acid Structures with 3DNA
Published on: April 26, 2013
Internal dynamics in a DNA triple helix probed by (1)H-(15)N-NMR spectroscopy
1Department of Molecular Biology and Biochemistry, Molecular Biophysics Program, Wesleyan University, Middletown, Connecticut 06459, USA.
Abstract:
The amino group of adenine plays a key role in maintaining DNA triple helical structures, being the only functional group in DNA that is involved in both Watson-Crick and Hoogsteen hydrogen bonds. In the present work we have probed the internal dynamics of the adenine amino group in the intramolecular YRY triple helix formed by the 31-mer DNA oligonucleotide d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT). The DNA triple helix was specifically labeled with (15)N at the amino group of the adenine in the fifth position. The rotation rate of the labeled amino group was measured as a function of temperature using (1)H-(15)N heteronuclear NMR spectroscopy. The results indicate that, in the DNA triple helix, the rotation of the adenine amino group is greatly slowed relative to that in a DNA double helix. The temperature dependence of the rotation rate suggests a large entropic contribution to this effect, which may originate from different hydration patterns of the adenine amino group in the two structures.
More Related Videos
14:55Atomic Scale Structural Studies of Macromolecular Assemblies by Solid-state Nuclear Magnetic Resonance Spectroscopy
Published on: September 17, 2017
09:25NMR 15N Relaxation Experiments for the Investigation of Picosecond to Nanoseconds Structural Dynamics of Proteins
Published on: November 1, 2024
Related Concept Videos
¹H NMR: Interpreting Distorted and Overlapping Signals
As Δν decreases and the signals move closer, the doublets appear increasingly distorted. The intensities of the inner lines increase at the cost of those of the outer lines as the signals are slanted or...
¹H NMR of Conformationally Flexible Molecules: Temporal Resolution
¹H NMR of Labile Protons: Temporal Resolution
The –OH proton in alcohols typically appears in the range of δ 2 to 5 ppm but can vary depending on the specific...
NMR Spectroscopy: Spin–Spin Coupling
Interpreting ¹H NMR Signal Splitting: The (n + 1) Rule
¹H NMR of Conformationally Flexible Molecules: Variable-Temperature NMR