Search research articles

ABOUT JoVE

Overview Leadership Blog JoVE Help Center

AUTHORS

Publishing Process Editorial Board Scope & Policies Peer Review FAQ Submit

LIBRARIANS

Testimonials Subscriptions Access Resources Library Advisory Board FAQ

RESEARCH

JoVE Journal Methods Collections JoVE Encyclopedia of Experiments Archive

EDUCATION

JoVE Core JoVE Business JoVE Science Education JoVE Lab Manual Faculty Resource Center Faculty Site

Terms & Conditions of Use

Search research articles

Related Experiment Videos

Putative DNA quadruplex formation within the human c-kit oncogene.

Sarah Rankin¹, Anthony P Reszka, Julian Huppert

¹Cancer Research UK Biomolecular Structure Group, The School of Pharmacy, University of London, 29-39 Brunswick Square, London WC1N 1AX, UK.

Journal of the American Chemical Society

|July 28, 2005

Summary

This summary is machine-generated.

Related Concept Videos

You might also read

Related Articles

Articles linked to this work by shared authors, journal, and citation graph.

Sort by

Same author

Sport Supplement Use in 14-18-Year-Old Adolescents: A Single-Group Pre-Post Social Media Educational Intervention Study.

Nutrients·2026

Same author

Spatially tunable multiomic sequencing using light-driven combinatorial barcoding of molecules in tissues.

Proceedings of the National Academy of Sciences of the United States of America·2026

Same author

Multifaceted biological and computational assessment of aromatic and N-heteroaromatic non-substituted thiosemicarbazones.

Scientific reports·2026

Same author

Degradation of G-quadruplex-binding proteins in chromatin using G4-ligand-based proteolysis-targeting chimeras.

Nature chemistry·2026

Same author

Novel Pyridine-Based Thiazolyl-Hydrazone as a Promising Attenuator of <i>Pseudomonas aeruginosa</i> Pathogenicity by Targeting Quorum Sensing.

International journal of molecular sciences·2026

Same author

Dissecting the Binding Interactions of the Chromatin Remodeler SMARCA4 with G-Quadruplex DNA.

Biochemistry·2026

Same journal

Decoding Galectin-Glycan Recognition with <sup>19</sup>F-Tagged Lectins: from Simple Glycans to the Cellular Glycocalyx.

Journal of the American Chemical Society·2026

Same journal

Open- and Closed-Shell Roles of Sensitizer and Annihilator in Pseudo-Single Component Mixtures for Upconversion.

Journal of the American Chemical Society·2026

Same journal

Pressure-Induced Superconductivity at 15 K in van-der-Waals Ferroelectric CuInP<sub>2</sub>S<sub>6</sub>.

Journal of the American Chemical Society·2026

Same journal

Carbene Analogues of Group 15: Reduction of s-Hydrindacene-Based Chloropnictogenium Ions To Access an Antimony Hydride Monocation and a Trinuclear Bismuth Dication.

Journal of the American Chemical Society·2026

Same journal

Chiral-Ligand-Modulated Nickel-Catalyzed Stereoselective Radical Migratory C2-Arylation of Carbohydrates.

Journal of the American Chemical Society·2026

Same journal

Coordination-Constraint-Driven Enhanced Chirality Induction in Perovskite Quantum Dot Solids.

Journal of the American Chemical Society·2026

See all related articles

A specific DNA sequence in the c-kit oncogene promoter forms a stable quadruplex structure. This finding suggests fewer such structures exist in the genome and offers a potential new cancer therapy target.

Area of Science:

Genomics
Structural Biology
Oncology

Background:

The c-kit oncogene plays a role in various cancers.
DNA can form complex structures beyond the double helix, such as quadruplexes.
The prevalence of genomic quadruplexes is not fully understood.

Purpose of the Study:

To investigate the structural properties of a specific DNA sequence from the c-kit oncogene promoter.
To determine if this sequence forms a quadruplex structure under physiological conditions.
To assess the impact of sequence variations on quadruplex formation.

Main Methods:

Nuclear Magnetic Resonance (NMR) spectroscopy
Circular Dichroism (CD) spectroscopy
Melting temperature (Tm) measurements

Related Experiment Videos

Main Results:

The DNA sequence d(AGGGAGGGCGCTGGGAGGAGGG) forms a stable four-stranded quadruplex structure.
This quadruplex formation occurs under physiological conditions.
Minor sequence modifications between guanine tracts prevented quadruplex formation.

Conclusions:

The c-kit promoter contains a sequence capable of forming a G-quadruplex structure.
Genomic quadruplex formation may be less common than previously hypothesized.
The c-kit quadruplex represents a potential novel therapeutic target for c-kit-driven cancers.