Related Experiment Videos
Conformation of an RNA pseudoknot
J D Puglisi1, J R Wyatt, I Tinoco
1Department of Chemistry, University of California, Berkeley 94720.
Journal of Molecular Biology
|July 30, 1990
Summary
This study reveals the RNA pseudoknot structure using spectroscopy. The findings confirm a stacked helical formation, characteristic of A-form geometry, with minor distortions.
Area of Science:
- Molecular Biology
- Biochemistry
- Structural Biology
Background:
- RNA pseudoknots are crucial non-coding RNA structures.
- Understanding their 3D conformation is key to their function.
Purpose of the Study:
- To elucidate the secondary and tertiary structure of the GCGAUUUCUGACCGCUUUUUUGUCAG RNA oligonucleotide.
- To validate existing models of RNA pseudoknot formation.
Main Methods:
- Nuclear magnetic resonance (NMR) spectroscopy.
- Biochemical and chemical probing techniques.
- Analysis of imino proton spectra and nuclear Overhauser effects (NOEs).
Main Results:
- NMR data indicate the formation of an RNA pseudoknot.
- Two distinct helical stem regions were identified and shown to stack.
- A-form helical geometry was confirmed, with slight distortions at stem-loop junctions.
Conclusions:
- The determined structure is consistent with a stacked pseudoknot model.
- The findings provide detailed insights into RNA structural dynamics and folding.