Related Experiment Video
Updated: May 24, 2026

Combining Reflectance Confocal Microscopy with Optical Coherence Tomography for Noninvasive Diagnosis of Skin Cancers via Image Acquisition
Published on: August 18, 2022
New strategy for rapid diagnosis and characterization of keratomycosis
Pablo Goldschmidt1, Sandrine Degorge, Djida Benallaoua
1Centre Hospitalier National d'Ophtalmologie des Quinze-Vingts, Paris, France. pablogol@aol.com
Purpose:
The first-line therapy for patients with keratitis is different for bacteria, filamentous fungi, and yeasts. The timely onset of treatments depends on rapid and accurate diagnosis. However, fungal cultures produce high rates of false-negative results. Nucleic acid amplification techniques (polymerase chain reaction [PCR]) improve fungal diagnosis performance, but they require complex postamplification procedures to differentiate filamentous fungi from yeasts or to identify the agent. The objective of this work was to develop a new diagnostic strategy based on real-time PCR high-resolution melting (HRM) analysis that in 1 run (a) detects and semiquantifies yeasts and filamentous fungi, (b) differentiates yeasts from filamentous fungi, and (c) discriminates among relevant species of yeasts.
Design:
Experimental study to compare HRM diagnosis performances with microscopic examination of corneal scrapings and fungal culture.
Participants And Controls:
High-resolution melting detection limits and specificity were assessed with (a) isolated strains; (b) agents (other than fungi) producing keratitis; (c) corneal scrapings from fungal keratitis (culture positive and negative); and (d) corneal scrapings from bacterial, viral, or Acanthamoeba keratitis.
Methods:
The DNA extracted from cornea specimens was mixed with primers diluted in the MeltDoctor HRM Master Mix (Applied Biosystems, Paris, France) in 2 tubes, the first for yeasts, containing the forward primer CandUn (5'CATGCCTGTTTGAGCGTC) and the reverse primer FungUn2 (5'TCCTCCGCTTATTGATATGCT), and the second for filamentous fungi, containing the forward primer FilamUn1 (5'TGCCTGTCCGAGCGTCAT) and FungUn2. Molecular probes were not necessary. The yields of DNA extraction and the PCR inhibitors were monitored by adding internal controls to each sample.
Main Outcome Measures:
Detection of fungi in corneal samples by HRM.
Results:
High-resolution melting consistently detects the equivalent of 0.1 colony-forming units /ml of yeasts and filamentous fungi, differentiates filamentous fungi from yeasts, and discriminates among relevant species of yeasts. High-resolution melting sensitivity and specificity were 100% for culture-positive samples, detecting and characterizing fungi in 7 of 10 culture-negative suspected fungal keratitis.
Conclusions:
High-resolution melting is a new, sensitive, specific, and inexpensive test that detects fungi and differentiates filamentous fungi from yeasts directly from clinical specimens in less than 2.30 hours after DNA extraction.