Related Experiment Videos
DNA-binding protein activated by gamma radiation in human cells
Molecular and Cellular Biology
|October 1, 1990
Summary
A novel DNA-binding protein appears in human cell nuclei after ionizing radiation exposure. This protein, specific to radiation and radiomimetic agents, translocates from the cytoplasm and is involved in DNA damage response.
Area of Science:
- Cellular biology
- Molecular biology
- Radiation biology
Background:
- DNA damage-inducible responses in mammalian cells often lack specificity.
- The roles of induced proteins in DNA processing and transcriptional control are not fully understood.
Purpose of the Study:
- To identify and characterize a specific DNA-binding protein induced by ionizing radiation in human cells.
Main Methods:
- Utilized DNA-binding studies with simian virus 40 enhancer sequences.
- Employed Southwestern and DNase I footprint analyses.
- Investigated protein translocation and induction mechanisms.
Main Results:
- Identified a novel, radiation-specific DNA-binding protein (43 kDa) in human cell nuclei post-ionizing radiation.
- Observed dose-dependent and transient nuclear appearance peaking at 1 hour.
- Demonstrated cytoplasmic presence in untreated cells with translocation upon radiation exposure.
- Determined the specific DNA-binding motif as pTGTCAGTTAGGGTACAGTCAATCCCAp.
Conclusions:
- A previously unreported 43 kDa DNA-binding protein is specifically induced by ionizing radiation in human cells.
- This protein translocates to the nucleus from the cytoplasm following radiation exposure.
- The findings contribute to understanding the specificity of DNA damage-inducible responses.