Related Experiment Video
Updated: Apr 14, 2026

Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen
Published on: June 3, 2018
DNA Functionalized Direct Electro-deposited Gold nanoaggregates for Efficient Detection of Salmonella typhi
Anu Singh1, Meenakshi Choudhary2, M P Singh2
1Advanced Instrumentation Research, Jawaharlal Nehru University, New Delhi-110067, India; School of Life Sciences, Jaipur National University, Jaipur, Rajasthan-302025, India.
Abstract:
Direct electro-deposition of gold nano-aggregates (GNAs) was carried out to fabricate electrochemical DNA biosensor for the detection of Salmonella typhi in urine and blood samples. Size of depositing GNAs was controlled by regulating electro-deposition parameters at physiological pH. This facilitated achieving biocompatible GNAs with desired electrochemical behaviour and enhanced surface area to achieve higher DNA loading. Salmonella typhi (S. typhi) specific 5'amine modified single stranded DNA (ssDNA, NH2-(C6)-5'CGTGCGCGACGCCCGCCGCC3') was covalently immobilized on to GNAs-ITO (indium tin oxide) electrode. Dynamic detection range of 4 aM - 24 fM. using methylene blue (MB) redox indicator at 25 °C was achieved using ssDNA-GNAs-ITO bio-electrode to detect the complimentary target sequence (5'GGCGGCGGGCGTCGCGCACG 3') through differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS). Selectivity of designed electrode was ascertained by response signal for complementary, non-complementary and 1 base mismatch sequences. Furthermore, clear distinction in complementary and non-complimentary targets was obtained by EIS studies for genomic DNA in culture spiked biological fluids 'CSBF' (blood and urine). This study for detection of S. typhi from urine and blood samples using fabricated ssDNA-GNA-ITO bio-electrode showed promising results and have potential to be used as sensor for real patient samples.

