Probing the Ionic Atmosphere and Hydration of the c-MYC i-Motif

G-quadruplexes and i-motifs are noncanonical secondary structures of DNA that appear to play a number of regulatory roles in the genome with clear connection to disease. Characterization of the forces stabilizing these structures is necessary for developing an ability to induce G-quadruplex and/or i-motif structures at selected genomic loci in a controlled manner. We report here the results of pH-dependent acoustic and densimetric measurements and UV melting experiments at elevated pressures to scrutinize changes in hydration and ionic atmosphere accompanying i-motif formation by the C-rich DNA sequence from the promoter region of the human c-MYC oncogene [5'-d(TTACCCACCCTACCCACCCTCA)] (ODN). We also conducted pH-dependent acoustic and densimetric characterizations of two DNA molecules that are compositionally identical to ODN but do not adopt the i-motif conformation, 5'-d(CTCTCACCACACCACACCTCTC) (ODN1) and 5'-d(CACACTCCTCACCTCTCCACAC) (ODN2). Our results reveal that i-motif formation by ODN is not accompanied by changes in volume and compressibility. The volumetric similarity of the i-motif and coil states of ODN implies a fortuitous compensation between changes in the intrinsic and hydration contributions to volume and compressibility. Analysis of the pH-dependent volumetric profiles of ODN, ODN1, and ODN2, along with the data on volumetric changes accompanying the protonation of isolated cytosine and deoxycytidine, suggests that protonation of the cytosines in the oligonucleotides causes release of the majority if not all of their counterions to the bulk. Thus, in the i-motif conformation, the oligomer no longer acts as a polyelectrolyte insofar as counterions are concerned. We discuss the biological ramifications of our results.