Binding of l-Argininamide to a DNA Aptamer: A Volumetric Study

We use a combination of volumetric and spectroscopic techniques to characterize the binding of l-argininamide to its aptamer, the 24-base DNA hairpin 5'-d(GATCGAAACGTAGCGCCTTCGATC)-3'. The binding causes increases in volume, Δ V, and adiabatic compressibility, Δ K_S, of 12 ± 7 cm³ mol^-1 bar and (73 ± 8) × 10^-4 cm³ mol^-1 bar^-1, respectively. These volumetric results combined with structural data reveal that the binding is accompanied by release of 73 ± 27 waters from the hydration shells of the interacting molecules to the bulk. We use the estimated change in hydration to estimate the hydration, Δ S_hyd, and configurational, Δ S_conf, contributions to the binding entropy. The large and unfavorable change in configurational entropy, Δ S_conf, is nearly compensated by a favorable change in the hydration contribution, Δ S_hyd.