Related Experiment Video
Updated: Jan 29, 2026

Leaf Area Index Estimation Using Three Distinct Methods in Pure Deciduous Stands
Published on: August 29, 2019
First Report of Squash leaf curl virus in Cucurbits in Lebanon
H Sobh1, J Samsatly1, M Jawhari1
1Department of Agricultural Sciences, Faculty of Agricultural and Food Sciences, American University of Beirut, P.O. Box 11-0236, Beirut, Lebanon.
Abstract:
During the second squash cropping season, which coincides with high whitefly populations, a high incidence of plants with severe leaf curl symptoms was observed. Many farmers reported yield losses ranging from 70 to 80%. Surveys were conducted over five cropping seasons (2008 to 2010) and covered the coastal areas of Lebanon. A total of 675 samples were collected, including cucumber (Cucumis sativus), squash (Cucurbita sp.), melon (Cucumis melo), and watermelon (Citrullus lanatus). All squash samples had leaf curl symptoms, whereas 75 to 85% of cucumber, melon, and watermelon samples showed yellowing symptoms. The remaining 15 to 25% were asymptomatic. Total nucleic acids were extracted according to a small-scale CTAB protocol (4). PCR assays were initially conducted using the universal degenerate primers PAL1v1978 and PAR1c496, designed to detect DNA-A of several begomoviruses (3). Following sequencing of 22 randomly selected amplicons, BLASTN analysis showed that 19 samples were infected with Squash leaf curl virus (SLCV). SLCV specific primers: (SqA1R: 5'AGCTGTATCTTGGGCAACAGA3' and SqA2F: 5'TATCTCCCATCTTGGCAAGG3'; amplicon size: 601 bp) were used for detection in the 675 samples. SLCV was detected in 223/249 (89%), 83/145 (57%), 129/229 (56%), and 25/52 (48%) of squash, cucumber, melon, and watermelon samples, respectively. The SLCV genome from a symptomatic squash plant collected from Akkar, North Lebanon, was amplified by rolling circle amplification (RCA) using the TempliPhi Amplification Kit (GE Healthcare). The product was used for biolistic inoculation of squash and cucumber as described (2). Severe leaf curl symptoms were observed on 7/10 of the squash seedlings (cv. Camelia F1) within 2 weeks of inoculation. However, no symptoms were observed on cucumber (cv. Beit alpha) 1 month after inoculation, even though 6/11 (54%) of the plants were positive for SLCV in PCR assays. Several primer sets were used for sequencing the full SLCV genome using the RCA product as template. The sequences were submitted to GenBank under accession numbers HM368373 and HM368374 (SLCV DNA A and B, respectively). Phylogenetic analysis showed that SLCV DNA A was most closely related to SLCV isolates from Egypt (DQ285019) and Israel (HQ184436) with 99% nucleotide identity; SLCV DNA B was most closely related to the same SLCV isolate from Israel (HQ184437) with 99% nucleotide identity. SLCV was first observed on squash in California in 1977, but was introduced during the last decade to the Mediterranean region (1) and currently is widespread all over Lebanon, posing a great threat to squash production. References: (1) Antignus et al. Phytoparasitica 31:415, 2003. (2) Guenoune-Gelbart et al. J. Virol. Methods 168:87, 2010. (3) Rojas et al. Plant Dis. 77:340, 1993. (4) Zhang et al. J. Virol. Methods 71:45, 1998.
Related Concept Videos
Divergence and Curl
Divergence and Curl of Electric Field
Divergence and Curl of Magnetic Field
What are Viruses?
Data Reporting and Recording
Types of Reports I: Hands-off Report
Following are the key components and categories of hand-off reports:
Purpose and Process:

