Related Experiment Video
Updated: Jan 29, 2026

Bimolecular Fluorescence Complementation BiFC Assay for Protein-Protein Interaction in Onion Cells Using the Helios Gene Gun
Published on: June 12, 2010
First Report of Shallot virus X in Onion in Sudan
K Hamed1, W Menzel1, M E Mohamed2
1Leibniz Institute DSMZ, Plant Virus Department, Inhoffenstrasse 7B, 38124 Braunschweig, Germany.
Abstract:
Onion (Alium cepa L.) is among the most important vegetable field crops in Sudan. During a disease survey in crops (cvs. Kamleen Yellow and Abu-freua) conducted in 2010, samples showing mild mottling symptoms were collected from Shambat Research Station Farm, Khartoum North, Sudan. A CF-11 cellulose chromatography dsRNA preparation (4) of a mixed onion leaf sample of five plants (20 g) resulted, apart from smaller dsRNAs up to 3 kbp, in a high molecular weight dsRNA of approximately 9 kbp. This dsRNA was used as a template for a random reverse transcriptase (RT)-PCR followed by cloning (4) and sequencing of two randomly selected clones by the ABI BigDye Terminator v3.1 Cycle Sequencing Kit. Comparison with sequences available at GenBank revealed high identities to Shallot virus X (ShVX). ShVX is the type member of the genus Allexivirus (Alphaflexiviridae). One sequence obtained showed 84% nt and 98% aa sequence identity (genome position 414 to 1,285 of Accession No. M97264) to the replicase, whereas the other sequence partially covered the ORF4 and coat protein (CP) coding region (7,127 to 7,998). This sequence showed 80% nt (entire sequence) and 80/89% aa sequence identity to the ORF4 encoded protein/coat protein of a Russian ShVX isolate, respectively. ShVX was first reported in shallot in Russia (2) and subsequently in the Netherlands, Germany, India (3), and New Zealand (1). To confirm the presence of ShVX in Sudan, 32 symptomatic leaf samples were collected in 2011 from different onion fields in Khartoum North, with a similar disease incidence compared to 2010. Thirty-one of these onion samples reacted positively in a double antibody sandwich-ELISA with a ShVX-specific antiserum (DSMZ AS-1042). Total RNA was extracted from five ShVX-ELISA positive onion samples using the RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer's protocol. Two primer pairs were also designed on the basis of sequences obtained in the random RT-PCR approach, targeting a 659-bp fragment of the coat protein region (ShVX-CPs 5'GTTGAATGTGGCGAGCGCAA3' and ShVX-CPas 5'AGTGCAGAAGCCTTCCACA3') or a 686-bp fragment of the replicase (ShVX-Rs 5'ATGTACTTCGGTACGGCATCA3' and ShVX-R-as 5'TAATCGAATGAGGTCGGCCA3'). Fragments of the expected sizes were obtained for all positive samples. One RT-PCR product of each primer pair was directly sequenced, showing high sequence identities to those previously obtained (>98%). The random RT-PCR sequences obtained in this study were submitted to GenBank (JQ751056 and JQ751057). On the basis of the nucleotide sequences obtained with the dsRNA template, ShVX specific RT-PCR, and ELISA, the presence of ShVX in Sudan was confirmed in two consecutive years. To our knowledge, this is the first report of ShVX in Sudan and Africa, indicating this virus is more widespread than previously reported. The presence of ShVX also suggests the presence of its only known vector, the mite Aceria tulipae. The virus may have been introduced to Sudan by infected onion sets. Even if the impact of ShVX on onion production has not been determined, its identification and the availability of a diagnostic antiserum may be helpful to select virus-free propagation material in order to achieve sustainable onion production in Sudan. References: (1) Z. Egusquiza et al. New Disease Reports 18:29, 2008. (2) K. V. Kanyuka et al. J. Gen. Virol. 73:2553, 1992. (3) S. Majumder et al. New Disease Reports 15:52, 2007. (4) W. Menzel et al. Arch. Virol. 154:1343, 2009.
Related Concept Videos
What are Viruses?
Data Reporting and Recording
Types of Reports I: Hands-off Report
Following are the key components and categories of hand-off reports:
Purpose and Process:
Types of Reports II: Incident or Occurrence Report
Purposes:
In the healthcare industry, reports play a crucial role in documenting incidents within an agency. The primary objective of these reports is to ensure patient safety, uphold the...
Types of Reports III: Telephone and Verbal Reports
Here's an overview of each type:
Telephone Orders
Reporter Genes

