Related Experiment Video
Updated: Jan 29, 2026

Virus-induced Gene Silencing VIGS in Nicotiana benthamiana and Tomato
Published on: June 10, 2009
First Report of Tomato yellow leaf curl Thailand virus in Taiwan
F-J Jan1, S K Green2, S L Shih2
1Department of Plant Pathology, National Chung Hsing University, Taichung 402, Taiwan.
Abstract:
During the 2006 winter and 2007 spring seasons, tomato lines carrying the Ty2 gene, which confers resistance to the Tomato leaf curl Taiwan virus (GenBank Accession No. U88692), showed severe yellowing, leaf curl, and stunting symptoms in several locations in Tainan County, Taiwan. Whiteflies were found to be associated with symptomatic plants, and disease incidences of almost 100% were observed. The presence of a new resistance breaking begomovirus was suspected. Six symptomatic leaf samples of three different tomato plants from each infected field were collected in Liouying (LY3, 7, and 8) and Sigang (SG9, 13, and 18) townships in Tainan County. Viral DNAs were extracted (2), and PCR with previously described primers was used to detect the presence of begomoviral DNA-A (4), DNA-B (3), and associated satellite DNA (1). Begomoviral DNA-A was detected in all tested samples. The PCR-amplified 1.5-kb viral DNA-A from one positive sample from each location (LY3 and SG18) was cloned and sequenced. On the basis of the 1.5 kb DNA-A sequences, specific primers were designed for cloning and sequencing the complete viral DNA-A, which was 2,744 bp for both the Liouying (GenBank Accession No. EF577266) and Sigang (GenBank Accession No. EF577264) isolates. Sequence analyses were conducted with DNAMAN sequence analysis software (Lynnon Corporation, Vaudreuil, Quebec, Canada). The DNA-A of both isolates contained the conserved nanonucleotides-TAATATTAC and six open reading frames, including two in the virus sense (AV1 and AV2) and four in the complementary sense (AC1 to AC4). On the basis of their 99.5% nucleotide identity, they are considered isolates of the same species. BLASTn analysis and sequence comparison with those available in the GenBank database ( http://www.ncbi.nlm.nih.gov ) indicated that the two isolates had the highest nucleotide identity (more than 98.4%) with the DNA-A of the Tomato yellow leaf curl Thailand virus (TYLCTHV; GenBank Accession No. AY514631). Virus-associated satellite DNA was not found in any of the samples. However, DNA-B was detected in all six samples, providing further evidence that the two isolates were the same as the bipartite TYLCTHV. All samples, except the LY3, were also found to be infected with Tomato leaf curl Taiwan virus (ToLCTWV), as indicated by a positive PCR reaction using the ToLCTWV-specific primer pair KD-PAV1 (5'ATCGTGTTGGGAAGAGGTTT3') and KD-PAC1 (5'GGAGAAAGCTCCCAAAGATT3'). A pure TYLCTHV isolate of LY3 was obtained in Lycopersicum esculentum TK70 by transmission with Bemisia tabaci Biotype B. The isolated TYLCTHV was found to infect L. esculentum H24 (resistant to ToLCTWV) and induce typical yellow leaf curl symptoms. To our knowledge, this is the first report of the presence of TYLCTHV in Taiwan. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) R. L. Gilbertson et al. J. Gen. Virol. 72:2843, 1991. (3) S. K. Green et al. Plant Dis. 85:1286, 2001. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.
Related Concept Videos
Divergence and Curl
Divergence and Curl of Electric Field
Divergence and Curl of Magnetic Field
What are Viruses?
Data Reporting and Recording
Types of Reports I: Hands-off Report
Following are the key components and categories of hand-off reports:
Purpose and Process:

