Single-Molecule MicroRNA Electrochemiluminescence Detection Using Cyclometalated Dinuclear Ir(III) Complex with...

The realization of electrochemiluminescence (ECL) detection at the single-molecule level is a longstanding goal of ECL assay that requires a novel ECL probe with significantly enhanced luminescence. Here, the synergistic effect of electrochemiluminescence (ECL) is observed unprecedentedly in a new cyclometalated dinuclear Ir(III) complex [Ir₂(dfppy)₄(imiphenH)]PF₆ (1·PF₆, PF₆^- = hexafluorophosphate) in which two {Ir(dfppy)₂}⁺ units are bridged by an imiphenH^- ligand. The ECL intensity from complex 1·PF₆ is 4.4 and 28.7 times as high as that of its reference mononuclear complexes 2 and 3·PF₆, respectively. Theoretical calculation reveals that the S₀ to S₁ excitation is a local excitation in 1·PF₆ with two electron-coupled Ir(III) centers, which contributes to the enhanced ECL. The synergistic effect of ECL in 1·PF₆ can be used to detect microRNA 21 at the single-molecule level (microRNA 21: UAGCUUAUCAGACUGAUGUUGA), with detectable ECL emission from this complex intercalated in DNA/microRNA 21 duplex as low as 90 helix molecules. The finding of the synergistic effect of ECL will not only provide a novel strategy for the modulation of ECL intensity but also enable the detection of microRNA at the single-molecule level.