Related Experiment Video
Updated: Aug 5, 2026
11:09
Chromatin Isolation by RNA Purification (ChIRP)
Published on: March 25, 2012
Nucleotide sequence of small chromatin-associated RNA (fr3 RNA)
N Brajanović-Urosević1, H Naora, G C Mills
1Department of Human Biological Chemistry and Genetics, University of Texas Medical Branch, Galveston 77550.
European Journal of Biochemistry
|April 15, 1988
Summary
Researchers identified a 30-nucleotide small RNA in rat liver. This RNA sequence matches the 3
Area of Science:
- Molecular Biology
- RNA Biology
- Genetics
Background:
- Small RNAs are crucial components of cellular processes.
- Non-histone chromosomal proteins are involved in gene regulation.
- Previous research identified a small RNA in specific cellular fractions.
Purpose of the Study:
- To isolate and characterize a specific small RNA from rat liver.
- To determine the sequence of the isolated small RNA.
- To investigate the relationship between this RNA and known RNA species.
Main Methods:
- Isolation of small RNA from the non-histone chromosomal protein fraction of rat liver.
- RNA sequencing to determine the nucleotide sequence.
- Sequence comparison with known RNA databases.
Main Results:
- A small RNA molecule of 30 nucleotides was successfully isolated from rat liver.
- The determined sequence of the RNA is 5'AGUGGGGGACUGCGUUCGCGCUCUCCCCUG3'.
- This sequence was found to be identical to the 3' terminal 30 nucleotides of small nuclear U1 RNA.
Conclusions:
- The identified small RNA is the 3' end of U1 small nuclear RNA.
- This finding suggests potential roles for U1 RNA fragments in cellular processes.
- Further research is needed to elucidate the specific functions of this RNA fragment.
Related Concept Videos
02:21Chromatin Packaging
Each human somatic cell contains 6 billion base-pairs of DNA. Each base-pair is 0.34 nm long, which means that each diploid cell contains a staggering 2 meters of DNA. How is such a long DNA strand packed inside a nucleus measuring only 10 - 20 microns in diameter?
The chromatin
In combination with specialized DNA binding protein called Histones, the DNA double helix forms a compact DNA: protein complex called chromatin. The chromatin itself is further compacted into higher-order structures.
The chromatin
In combination with specialized DNA binding protein called Histones, the DNA double helix forms a compact DNA: protein complex called chromatin. The chromatin itself is further compacted into higher-order structures.
02:35Chromatin Position Affects Gene Expression
Chromatin is the massive complex of DNA and proteins packaged inside the nucleus. The complexity of chromatin folding and how it is packaged inside the nucleus greatly influences access to genetic information. Generally, the nucleus' periphery is considered transcriptionally repressive, while the cell's interior is considered a transcriptionally active area.
Topologically Associated Domains (TADs)
The 3-dimensional positioning of chromatin in the nucleus influences the timing and level of...
Topologically Associated Domains (TADs)
The 3-dimensional positioning of chromatin in the nucleus influences the timing and level of...
02:41Chromatin Structure Regulates pre-mRNA Processing
In eukaryotic cells, nascent mRNA transcripts need to undergo many post-transcriptional modifications to reach the cell cytoplasm and translate into functional proteins. For a long time, transcription and pre-mRNA processing were considered two independent events that occur sequentially in the cell. However, it has now been well established that transcription and pre-mRNA processing are two simultaneous processes that are precisely regulated inside the cell.
The chromatin structure, especially...
The chromatin structure, especially...
02:53Ribosomal RNA Synthesis
Ribosome synthesis is a highly complex and coordinated process involving more than 200 assembly factors. The synthesis and processing of ribosomal components occurs not only in the nucleolus but also in the nucleoplasm and the cytoplasm of eukaryotic cells.
Ribosome biogenesis begins with the synthesis of 5S and 45S pre-rRNAs by distinct RNA polymerases. The primary transcripts are extensively processed and modified before they are bound and folded by ribosomal proteins and assembly factors,...
Ribosome biogenesis begins with the synthesis of 5S and 45S pre-rRNAs by distinct RNA polymerases. The primary transcripts are extensively processed and modified before they are bound and folded by ribosomal proteins and assembly factors,...
02:41Chromatin Structure and RNA Splicing
In eukaryotic cells, nascent mRNA transcripts need to undergo many post-transcriptional modifications to reach the cell cytoplasm and translate into functional proteins. For a long time, transcription and pre-mRNA processing were considered two independent events that occur sequentially in the cell. However, it has now been well established that transcription and pre-mRNA processing are two simultaneous processes that are precisely regulated inside the cell.
The chromatin structure, especially...
The chromatin structure, especially...
01:32Chromatin Packaging
Each human somatic cell contains 6 billion base pairs of DNA. Each base pair is 0.34 nm long, meaning each diploid cell contains a staggering 2 meters of DNA. This long DNA strand is packed inside a nucleus measuring only 10-20 microns in diameter with the help of specialized DNA-binding proteins called histones. Together they form a compact DNA-protein complex called chromatin. The chromatin is further compacted into higher-order structures. The highest level of compaction is achieved during...