Related Experiment Video
Updated: Aug 5, 2026

Chromatin Isolation by RNA Purification (ChIRP)
Published on: March 25, 2012
Nucleotide sequence of small chromatin-associated RNA (fr3 RNA)
N Brajanović-Urosević1, H Naora, G C Mills
1Department of Human Biological Chemistry and Genetics, University of Texas Medical Branch, Galveston 77550.
Abstract:
A small RNA found in the fraction on non-histone chromosomal proteins or rat liver and chicken reticulocytes [Holoubek, V., Deacon, N.J., Buckle, D.W. and Naora, H. (1983) Eur. J. Biochem. 137, 249-256] has been isolated from rat liver and then sequenced. The RNA is 30 nucleotides long and has the following composition: 5'AGUGGGGGACUGCGUUCGCGCUCUCCCCUG3'. This sequence is identical with the sequence of the last 30 nucleotides at the 3' end of small nuclear U1 RNA.
Related Concept Videos
Chromatin Packaging
The chromatin
In combination with specialized DNA binding protein called Histones, the DNA double helix forms a compact DNA: protein complex called chromatin. The chromatin itself is further compacted into higher-order structures.
Chromatin Position Affects Gene Expression
Topologically Associated Domains (TADs)
The 3-dimensional positioning of chromatin in the nucleus influences the timing and level of...
Chromatin Structure Regulates pre-mRNA Processing
The chromatin structure, especially...
Ribosomal RNA Synthesis
Ribosome biogenesis begins with the synthesis of 5S and 45S pre-rRNAs by distinct RNA polymerases. The primary transcripts are extensively processed and modified before they are bound and folded by ribosomal proteins and assembly factors,...
Chromatin Structure and RNA Splicing
The chromatin structure, especially...
Chromatin Packaging

