Related Experiment Video
Updated: Nov 1, 2025

Single-Molecule Fluorescence Visualization of DNA Polymerase Dynamics at G-Quadruplexes
Published on: April 4, 2025
G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold
Iva Kejnovská1, Petr Stadlbauer1, Lukáš Trantírek2
1Institute of Biophysics of the Czech Academy of Sciences, Královopolská 135, 612 65, Brno, Czech Republic.
Abstract:
Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.
Related Concept Videos
DNA Base Pairing
DNA Base Pairing
The DNA Helix
The DNA Helix
Proofreading
Proofreading
Errors During Replication are Corrected by the DNA Polymerase...

