Related Experiment Video
Updated: Sep 5, 2025

Author Spotlight: Exploring Cellular Zinc Regulation Through ZnT1 Functionality
Published on: June 2, 2023
Kinetic and Mechanistic Studies of the Terminal Uridylyltransferase, Zcchc11 (TUT4)
Ross L Stein1, David M Wilson1
1Twentyeight-Seven Therapeutics, 490 Arsenal Way, Watertown, Massachusetts 02472, United States.
Abstract:
Zcchc11 (TUT4, TENT3A, Z11) is a nucleotidyltransferase that catalyzes the 3'-polyuridylation of RNA. Our interest in this enzyme stems from its role in blocking the biogenesis of let-7, a family of microRNAs whose members act as tumor suppressors. Z11 polyuridylates pre-let-7, the precursor of let-7, when pre-let-7 is complexed with LIN28, an RNA-binding protein. Polyuridylation of pre-let-7 marks it for degradation. In addition to this LIN28-dependent activity, Z11 also has LIN28-independent activities. In this paper, we report the results of experiments that characterize LIN28-independent activities of Z11. Significant observations include the following. (1) Z11 uridylates not only mature let-7 species but also substrates as small as dinucleotides. (2) For both let-7i and the diribonucleotide AG, Z11 follows a steady-state ordered mechanism, with UTP adding before RNA. (3) Uridylation kinetics of let-7i (UGAGGUAGUAGUUUGUGCUGUU) and two truncated derivatives, GCUGUU and UU, indicate that Z11 manifests selectivity in Km,RNA; kcat,RNA values for the three substrates are nearly identical. (4) Z11 preferentially uridylates RNA lacking base-pairing near the 3' terminus. (5) Selectivity of Z11 toward ribonucleoside triphosphates is similar for let-7i and AG, with XTP preference: UTP > CTP > ATP ≫ GTP. Selectivity is manifested in Km,XTP, with kcat,XTP values being similar for UTP, CTP, and ATP. (6) Kinetic parameters for RNA turnover are dependent on the structure of the nucleoside triphosphate, consistent with recent structural data indicating stacking of the nucleoside triphosphate base with the base of the 3'-nucleotide of the substrate RNA (Faehnle et al., Nat. Struct. Mol. Biol. 2017, 24, 658).
Related Concept Videos
Allosteric Proteins-ATCase
Aspartate transcarbamoylase (ATCase) is a cytosolic enzyme that catalyzes the condensation of L-aspartate and carbamoyl phosphate to N-carbamoyl-L-aspartate. This reaction is the first step in pyrimidine biosynthesis. UTP and CTP, the end products of the pyrimidine synthesis...
ATP Synthase: Mechanism

