Variability within the rabbit C repeats and sequences shared with other SINES.

Area of Science:

• Genomics
• Molecular Evolution
• Bioinformatics

Background:

• Short interspersed repeats (SINEs) are mobile genetic elements found in eukaryotic genomes.
• The C family of SINEs is abundant in the rabbit genome, suggesting a specific dispersal mechanism.

Purpose of the Study:

• To determine the nucleotide sequence of additional C family SINE members in the rabbit genome.
• To compile sequences for an improved consensus sequence and analyze conservation and variability.
• To compare C repeat sequences with other mammalian SINEs.

Main Methods:

• Nucleotide sequencing of C family SINE members.
• Sequence compilation and consensus sequence generation.
• Comparative sequence analysis with other mammalian SINEs.

Main Results:

• An improved consensus sequence for rabbit C repeats was obtained.
• Most regions of the C repeat are conserved, but two regions exhibit high variability.
• Some repeats are truncated, with one retaining retroposon-like structures.
• C repeats show limited homology to other mammalian SINEs but share conserved sequence elements with primate and rodent SINEs.
• A conserved 27-nucleotide sequence, TCCCAGCAACCACATGGGAGGCAGAGA, was identified in all examined mammalian SINEs, with its 3' portion matching papovavirus replication origins.

Conclusions:

• The C family SINEs in rabbits likely dispersed via retroposition of an RNA polymerase III transcribed RNA.
• Variability in C repeats may reflect different evolutionary pressures or mechanisms.
• The identified conserved sequence suggests a functional role or common ancestral origin for mammalian SINEs, potentially linked to DNA replication machinery.