Related Experiment Video
Updated: May 2, 2026

Treating SCA1 Mice with Water-Soluble Compounds to Non-Specifically Boost Mitochondrial Function
Published on: January 22, 2017
Clinical Characterization and Mutation Analysis of 13 Iranian Ataxia Telangiectasia Patients: Introducing Two Novel
Mohsen Badalzadeh1, Maryam Soleimani Bavani2, Zahra Alizadeh3
1Immunology, Asthma and Allergy Research Institute, Tehran University of Medical Sciences, Tehran, Iran AND Children's Medical Center Hospital, Pediatrics Center of Excellence, Tehran University of Medical Sciences, Tehran, Iran. m.badalzadeh@gmail.com.
Abstract:
Ataxia Telangiectasia (A-T) is a rare autosomal recessive neurodegenerative disease caused by mutations in the ataxia telengiectasia mutated (ATM) gene. The gene is on chromosome 11q22-23 and codes for the protein kinase ATM, which plays an essential role in DNA damage repair. In this study, we review the clinical characteristics of 13 A-T patients, 2 of whom displayed novel mutations. Thirteen patients with ataxia-telangiectasia from 10 unrelated families were referred to Immunology, Asthma and Allergy Research Institute, Tehran, Iran. After clinical confirmation, blood samples were collected from the patients and their parents. Genetic analysis for 8 patients was conducted using whole-exome sequencing; in the other 3 patients, polymerase chain reaction was used, followed by sequencing. We identified 11 different mutations in the ATM gene. Two patients had mutations as compound heterozygous, while 9 other patients were homozygous for the mutations. Among these, 2 likely pathogenic mutations (ie, c.2639-1G>A and c.7940_7970delTTCCAGCAGACCAGCCAATTACTAAACTTAA) have not been reported. Our study highlights the significance of next-generation sequencing techniques in identifying novel ATM mutations in A-T patients. Although all reported A-T mutations reside in 1 gene, the absence of a mutation hotspot for this gene necessitates the use of next-generation sequencing techniques. Specifically, we identified 2 mutations that have not been reported previously, emphasizing the importance of continued research in this area. This study provides new insights into the genetic underpinnings of A-T and underscores the potential clinical implications of identifying novel mutations.
Related Concept Videos
Myocarditis II: Clinical Features and Diagnostic Tests
Acute Coronary Syndrome II: Pathophysiology and Clinical Manifestations
Acute Coronary Syndrome III: Diagnostic Studies
Aneurysm II: Clinical Manifestations and Diagnostic Studies
Spontaneous and Induced Mutations
Point and Frameshift Mutations

