Related Experiment Video
Updated: Aug 19, 2026

Nucleoside Triphosphates - From Synthesis to Biochemical Characterization
Published on: April 3, 2014
Modification of guanine bases by nucleoside phosphoramidite reagents during the solid phase synthesis of
Abstract:
Nucleoside 3'-phosphoramidite and chlorophosphite reagents have been found to react with the lactam function of guanine. This reaction caused unsatisfactory results when oligodeoxyribonucleotides containing a large number of guanine bases were prepared in an automated solid phase synthesizer. The guanine modification is unstable, and leads to depurination and chain cleavage. This side reaction can be eliminated by protecting the O6-position. A new O6-p-nitrophenylethyldeoxyguanosine phosphoramidite derivative, 8, was used to prepare sequences containing up to 24 guanine bases with greatly improved results. A hexatriacontanucleotide, d(CGCGGGGTGGAGCAGCCTGGTAGCTCGTCGGGCTCA), was also prepared using O6-protected deoxyguanosine nucleosides.
Related Concept Videos
Proofreading
DNA Base Pairing
Maxam-Gilbert Sequencing
Challenges of the Maxam-Gilbert Method
The...
Preparation of 1° Amines: Gabriel Synthesis
Strong bases like NaOH or KOH deprotonate the phthalimide to form the corresponding anion, which acts as a nucleophile. Further, the anion attacks an...
Proofreading
Errors During Replication are Corrected by the DNA Polymerase Enzyme
Biosynthesis of Nucleic Acids

