Synthetic guide sequence to generate CRISPR-Cas9 entry strains in C. elegans

Area of Science:

• Genetics
• Molecular Biology
• Developmental Biology

Background:

• CRISPR/Cas9 genome editing is a standard technique in C. elegans for generating mutants and tagging genes.
• The efficiency of single-guide RNA (sgRNA) sequences can vary, impacting experimental outcomes.
• The dpy-10 sgRNA is commonly used to create intermediate entry strains for efficient knock-ins.

Purpose of the Study:

• To develop and validate a novel synthetic sgRNA sequence for creating CRISPR entry strains in C. elegans.
• To provide an alternative to the dpy-10 sgRNA when it is unsuitable due to genomic linkage or experimental design.

Main Methods:

• Design and synthesis of a novel sgRNA sequence (GCTATCAACTATCCATATCG) not present in the C. elegans genome.
• Testing the efficiency of the synthetic sgRNA for generating entry strains in C. elegans.
• Comparison of knock-in efficiency with the established dpy-10 entry strain method.

Main Results:

• The synthetic sgRNA sequence demonstrated a knock-in efficiency ranging from 1-11% in C. elegans.
• This efficiency, while lower than dpy-10, is sufficient for many gene editing applications.
• The synthetic sgRNA is effective for generating entry strains in scenarios where dpy-10 is not viable.

Conclusions:

• A new, non-native synthetic sgRNA sequence expands the CRISPR toolkit for C. elegans researchers.
• This alternative sgRNA is particularly valuable for generating entry strains when the dpy-10 sequence presents limitations.
• The synthetic guide RNA enhances the versatility and applicability of CRISPR genome editing in C. elegans.