A Cytosine‑Bulged (3+1) Hybrid G‑Quadruplex Formed by the Chicken DNA Replication Origin

Guanine (G)-rich nucleic acid sequences, capable of folding into G-quadruplex (G4), are widely distributed in functionally important genomic regions and play key roles in DNA replication. Origin G-rich repeated elements (OGRE) have been identified at replication origins in mouse, Drosophila, human and chicken. However, G4 structures formed by OGRE remain poorly understood. Here, we report the first high‑resolution G4 structure formed by OGRE from the β-globin replication origin of chicken (Gallus gallus). The 23 nt DNA sequence d[GGGAACGCGGCATCAGGGTGGGG], termed ChOGRE23, folds into an intramolecular three-layer (3+1) hybrid G4 containing a cytosine bulge. Notably, the 5'-end guanine participating in the outermost G-quartet adopts an anti glycosidic conformation, representing a previously unobserved glycosidic alignment in unimolecular (3+1) hybrid G4s. Together with the cytosine bulge, these unusual structural features create a distinct molecular surface that may facilitate selective recognition by replication‑associated proteins or small molecules.