Rous sarcoma virus genome is terminally redundant: the 3' sequence

Area of Science:

• Molecular Biology
• Virology
• Genomics

Background:

• Rous sarcoma virus (RSV) is an avian retrovirus known to cause tumors.
• Understanding the structure of viral RNA genomes is crucial for deciphering replication and integration mechanisms.

Purpose of the Study:

• To determine the nucleotide sequence adjacent to the 3'-terminal poly(A) of RSV (Prague strain, subgroup C) 35S RNA.
• To investigate the implications of this sequence for the viral genome's structure and replication.

Main Methods:

• RNA sequencing using a primer extension method.
• Utilizing avian myeloblastosis virus reverse transcriptase (RNA-directed DNA polymerase).
• Hybridization of an oligothymidylic acid primer to the 3'-terminal poly(A) tail.

Main Results:

• The determined sequence adjacent to the poly(A) tail is 5'GCCAUUUUACCAUUCACCACpoly(A)3'.
• This identical sequence, excluding the poly(A) segment, was previously identified at the 5' terminus of RSV RNA.
• The findings demonstrate terminal redundancy in the RSV RNA genome.

Conclusions:

• The RSV RNA genome possesses terminally repeated sequences.
• This terminal redundancy likely plays a role in the endogenous in vitro copying of the complete viral genome by reverse transcriptase.
• Further investigation into the mechanisms facilitated by these repeated sequences is warranted.