Related Experiment Videos
Selective deuteration of RNA for NMR signal assignment
1Department of Biophysics and Biochemistry, School of Science, University of Tokyo, Japan.
Nucleic Acids Symposium Series
|January 1, 1995
Abstract:
For site-selective deuterium labeling of RNA, [5-2H]uridine phosphoramidite was prepared. The uridine at position 10 of a 25-mer RNA, GGACAGACUUCGGUCGGAGUACUCG, was labeled in two different manners for "positive" (U = [5-1H]U, U = [5-2H] U) and "negative"(U = [5-2H]U, U = [5-1H]U) observations. By comparison of NOESY spectra of the two labeled samples with that of the unlabeled RNA, we could unambiguously assign the H5-H6 signals of U10, and measure their NOE connectivities.