Related Experiment Video
Updated: Aug 8, 2026
Induction and Assessment of Class Switch Recombination in Purified Murine B Cells
Published on: August 14, 2010
Detection of an immunoglobulin switch region-specific DNA-binding protein in mitogen-stimulated mouse splenic B cells
R A Wuerffel1, A T Nathan, A L Kenter
1Department of Microbiology and Immunology, College of Medicine, University of Illinois, Chicago 60680.
Insights
Researchers identified a novel nuclear protein, NF-S mu, that binds to the immunoglobulin switch mu (S mu) sequence in stimulated B cells. This protein may play a key role in switch recombination.
Area of Science:
- Immunology
- Molecular Biology
- Genetics
Background:
- Immunoglobulin class switch recombination (CSR) is a critical process in adaptive immunity.
- The immunoglobulin switch mu (S mu) region is essential for initiating CSR.
- The molecular players regulating S mu recombination are not fully understood.
Purpose of the Study:
- To identify nuclear proteins that bind to the S mu sequence.
- To characterize the binding properties and kinetics of such proteins.
- To investigate the potential role of these proteins in CSR.
Main Methods:
- Electrophoretic mobility shift assays (EMSA) using a labeled S mu DNA probe.
- Methylation interference analysis to pinpoint DNA binding sites.
- Competition assays with mutated S mu sequences.
- Kinetic analysis of protein expression in stimulated B cells.
Main Results:
- A novel nuclear protein, termed NF-S mu, was detected in stimulated mouse splenic B cells.
- NF-S mu specifically binds to the S mu DNA sequence.
- Binding preferentially occurs at a run of four guanine residues flanked by GAGCT.
- NF-S mu expression kinetics correlate with S mu recombinational activity.
Conclusions:
- NF-S mu is a novel DNA-binding protein recognizing the S mu sequence.
- The binding characteristics suggest a specific role in regulating S mu recombination.
- NF-S mu is proposed as a potential effector molecule in immunoglobulin switch recombination.
Abstract:
We have detected a nuclear protein from lipopolysaccharide- and dextran sulfate-stimulated mouse splenic B cells which binds specifically to the immunoglobulin switch mu (S mu) sequence. We have termed the binding protein NF-S mu. DNA containing the S mu repeated sequence, GAGCTGGGGTGAGCTGAGCTGAGCT, was used as a probe in electrophoretic mobility shift assays. Methylation interference analysis indicated that binding centers on the run of four guanine residues. Competitions with mutated S mu sequences confirmed the importance of the run of G residues and revealed that optimal binding occurs when they are flanked by GAGCT. The kinetics of the expression of NF-S mu in splenic B cells treated with lipopolysaccharide and dextran sulfate parallels the induction of recombinational activity at S mu in these cells. On the basis of these data, we suggest that NF-S mu may be an effector of switch recombination.
