Related Experiment Videos
GG versus AG Platination: A Kinetic Study on Hairpin-Stabilized Duplex Oligonucleotides
Franck Legendre1, Jirí Kozelka, Jean-Claude Chottard
1Laboratoire de Chimie et Biochimie Pharmacologiques et Toxicologiques, Université René Descartes (Paris V), URA 400 CNRS, 45 Rue des Saints-Pères, 75270 Paris Cedex 06, France.
Abstract:
The kinetics of the reactions between the diaqua form of the antitumor drug cisplatin, cis-[Pt(NH(3))(2)(H(2)O)(2)](2+), and two hairpin-stabilized duplex oligonucleotides, d(TATGGTATTTTTATACCATA) (I) and d(TATAGTATTTTTATACTATA) (II), were investigated. Oligonucleotides I and II were used as models for GG and AG sequences within duplex DNA, which are known as the major sites of platinum binding. The two GG guanines of I are shown to react with similar rates (k(5)(') = 18 +/- 2 and k(3)(') = 15 +/- 1 M(-)(1) s(-)(1)), roughly twice as fast as the AG guanine of II (k(3)(') = 9 +/- 1 M(-)(1) s(-)(1)). Platination of the AG adenine of II was also observed to a minor extent (k(5)(') = 1.5 +/- 0.3 M(-)(1) s(-)(1)), whereas no other adenine of I or II was platinated to a detectable extent. The overall platination rate of I is approximately three times larger than that of II. The 3'-monoadduct of I undergoes chelation to the GG intrastrand adduct with a rate 10.5 times larger than the 5'-monoadduct (k(3)(')(c) = (1.9 +/- 0.1) x 10(-)(3) s(-)(1) and k(5)(')(c) = (0.18 +/- 0.05) x 10(-)(3) s(-)(1)). For II, the chelation rate constants of the guanine- and adenine-bound monoadducts are k(5)(')(c) = 0.3 +/- 0.1 and k(3)(')(c) = 0.08 +/- 0.01 s(-)(1), respectively. These results are discussed in relation to the platination kinetics determined for other model systems.