Related Experiment Video
Updated: Jan 29, 2026

Development of a Hepatitis B Virus Reporter System to Monitor the Early Stages of the Replication Cycle
Published on: February 1, 2017
First Report of Grapevine Leafroll-associated Virus 4 in Vineyards of Turkey
A Kaya1, S Erilmez1, I C Paylan2
1Plant Protection Research Institute, 35040 Bornova, Izmir, Turkey.
Abstract:
Turkey is one of the main grape producers in the world, with an annual production of about 4 million tons on approximately 500,000 hectares of viticulture areas, mainly in the Aegean, Southeast Anatolia, and Central Anatolia regions. Nearly 29% of the vineyards in Turkey are located in the Aegean region, with major growing districts including the provinces of Manisa and Izmir. Previous studies have shown that Grapevine leafroll-associated viruses (GLRaV-1, -2, -3, -5, -6, and -7), which cause Grapevine Leafroll Disease (GLD), were present in Turkish vineyards (1,2). Surveys in 2009 and 2011 were conducted to determine other viruses associated with this disease in commercial vineyards of the provinces of Manisa and Izmir. Leaves and young canes were randomly collected from individual symptomatic and symptomless grapevines (Vitis vinifera L.) of red or white cultivars in late summer and autumn. Symptoms observed in plants were reddening and downward rolling of leaves in red cultivars and yellowing of leaf tissue between main veins and leaf curling in white cultivars. In addition, affected grapevines appeared to have reduced growth resulting in smaller canopies. Samples were analyzed first by double antibody sandwich (DAS)-ELISA using commercial diagnostic kits (Bioreba, Switzerland) to GLRaV-4-9 according to the manufacturer's instructions. The results from serological assays on 145 samples revealed that five samples of cv. Syrah and three of cv. Round seedless from Izmir-Menderes and from Manisa-Alasehir, respectively, reacted positively with specific antibodies to GLRaV-4-9. The identification of GLRaV-4 was confirmed by reverse transcriptase-PCR and total nucleic acids were extracted by a silica capture method from fresh, symptomatic plant samples (3). The synthesis of complementary DNA (cDNA) was performed by a Fermentas cDNA synthesis kit in accordance with the procedure specified by the manufacturer and specific primers (Forward: CCAACTGTCGTGGGTATAAGGAAT, Reverse: CCCAGACACCGGTCCTATACT) were used according to methods described by Maliogka et al. (4). An expected PCR product of approximately 200 nt was obtained from symptomatic samples that were GLRaV-4 positive in DAS-ELISA. GLRaV, comprising GLRaV-4 as quarantine pests, are under official control in Turkey. To our knowledge, this is the first report of natural GLRaV-4 infection of grapevines in Turkey. References: (1) B. Akbas et al., J. Phytopathol. 155:122, 2007. (2) N. Buzkan et al., J. Phytopathol. 158:448, 2010. (3) X. Foissac et al., Acta Hortic. 550:37, 2001. (4) V. I. Maliogka et al., J. Virol. Methods 154:41, 2008.
Related Concept Videos
What are Viruses?
Data Reporting and Recording
Types of Reports I: Hands-off Report
Following are the key components and categories of hand-off reports:
Purpose and Process:
Types of Reports II: Incident or Occurrence Report
Purposes:
In the healthcare industry, reports play a crucial role in documenting incidents within an agency. The primary objective of these reports is to ensure patient safety, uphold the...
Dipeptidyl Peptidase 4 Inhibitors
Types of Reports III: Telephone and Verbal Reports
Here's an overview of each type:
Telephone Orders

