Related Experiment Video
Updated: Dec 27, 2025
Investigating the Pathogenesis of MYH7 Mutation Gly823Glu in Familial Hypertrophic Cardiomyopathy using a Mouse Model
Published on: August 8, 2022
Pathogenic EDA Mutations in Chinese Han Families With Hypohidrotic Ectodermal Dysplasia and Genotype-Phenotype: A
Yang Han1,2, Xiuli Wang1,2, Liyun Zheng1,2
1Department of Dermatology of First Affiliated Hospital, First Affiliated Hospital of Anhui Medical University, Hefei, China.
Background:
This study aimed to investigate the genetic causes of hypohidrotic ectodermal dysplasia (HED) in two families and elucidate the molecular pathogenesis of HED in Chinese Han patients.
Methods:
Whole-exome sequencing (WES) was used to screen HED-related genes in two family members, followed by confirmatory Sanger sequencing. Bioinformatics analysis was performed for the mutations. We reviewed HED-related articles in PubMed. χ 2- and Fisher's tests were used to analyze the genotype-phenotype correlations.
Results:
(1) WES identified EDA missense mutations [c.1127 C > T (p.T376M; NM_001005609)] in family 1 and an EDA nonframeshift deletion mutation [c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC (p.216_228delPPGPPGPPGPQGP; NM_001005609)] in family 2. Sanger sequencing validated the results. ANNOVAR (ANNOtate VARiation) annotation indicated that c.1127 c > T was a deleterious mutation. (2) The review of published papers revealed 68 novel mutations related to HED: 57 (83.8%) were EDA mutations, 8 (11.8%) were EDAR mutations, 2 (2.9%) were EDARADD mutations, 1 (1.5%) was a WNT10A mutation, 31 (45.6%) were missense mutations, 23 (33.8%) were deletion mutations, and 1 (1.5%) was an indel. Genotype-phenotype correlation analysis revealed that patients with EDA missense mutations had a higher frequency of hypohidrosis (P = 0.021).
Conclusions:
This study identified two EDA gene mutations in two Chinese Han HED families and provides a foundation for genetic diagnosis and counseling.
More Related Videos
06:41In Vivo Functional Study of Disease-associated Rare Human Variants Using Drosophila
Published on: August 20, 2019
08:22A Novel Strategy Combining Array-CGH, Whole-exome Sequencing and In Utero Electroporation in Rodents to Identify Causative Genes for Brain Malformations
Published on: December 1, 2017
Related Concept Videos
01:11Genetic Lingo
01:35Pedigree Analysis
01:09Epistasis Analysis
01:43Incomplete Dominance
02:27Background and Environment Affect Phenotype
An example of how genetic background affects phenotype can be seen in horses. The Extension gene in horses is responsible for their coat color. A wild-type gene (EE) produces black pigment in the coat, while a mutant gene (ee) produces red pigment. A...
01:33Pleiotropy